alivekittycuddler8ro alivekittycuddler8ro
  • 04-03-2022
  • Physics
contestada

What's the meaning of life?

Respuesta :

chibunduoyibe
chibunduoyibe chibunduoyibe
  • 04-03-2022

Explanation:

life is about the good and bad experiences

Answer Link

Otras preguntas

In Spanish America, single male colonists were encouraged to intermarry with indigenous women. True or False
There are 4 balls in a bag, each of a different color. 4 balls are picked out of the bag randomly, one at a time, and after the color is recorded, the ball is p
I need help, please help as soon as possible
The day my sibling reads a book I did, is the day I will never be allowed to read again. Iykyk
i need a valentine poem 14 lines long and every other line to rime except the last two
Can someone help me out What is the solution to the system graphed?
A buffer solution contains 0.345 M acetic acid and 0.377 M sodium acetate . If 0.0613 moles of potassium hydroxide are added to 250 mL of this buffer, what is t
What are two types of evidence that have helped biologists determine the ancestors of modern humans
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
84 is the product of Donnie's savings and 7 use the variable d to represent Donnie's savings