acadianelliot3309 acadianelliot3309

02-03-2022
Health

contestada

How does a scanning electron microscope form images?.

Respuesta :

kathywatters6 kathywatters6

10-03-2022

Answer:

the scanning electron microscope s e m produced images by scanning the simple with a high energy beam of electrons as electron interacts with the simple they produce secondary electrons back scattered electron and characteristic x-rays.

Answer Link

Otras preguntas

Could someone please help me with this question due in 3 minutes (ASAP)

What is the equation of the line that passes through the point (3, 3) and has a slope of o?

Can someone plzzz help me it’s Spanish!

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Help please! look at the screenshot below.

I don't know to much about this can you help me on it.

Why do we care how strong a rock is?

4 In general, the policy of the United States government toward Native Americans in the West was to A send the army to track them down, engage them in battle, a

What is the purpose of government? Select a quotation from a US president. Then, write an argumentative essay that explains why you

The 442nd Regimental Combat Team had about 14,000 soldiers, however over 9,400 were injured during combat, earning this unit what nickname? A. the defenders B.