rebeca1729
rebeca1729 rebeca1729
  • 02-12-2021
  • Mathematics
contestada

Consider the following number line

Consider the following number line class=

Respuesta :

ehylt
ehylt ehylt
  • 02-12-2021

Answer:

switch A and B and you will have the right answers

Step-by-step explanation:

Answer Link

Otras preguntas

How did the Hellenistic kings spread Greek culture
How would you say good-bye to a friend whom you might not see for a long time? a. Hasta luego. b. Hasta pronto. c. Hasta ahora. d. ¡Adiós! e. Hasta mañana.
Which statement describes a main difference between CPR performed on adults and CPR performed on infants? a) For adults only, alternate between compressions a
which statement is true for a career as a graphic designer?
Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9
show work and factor ?
The area of a rectangle is 55 m^2 , and the length of the rectangle is 4 m less than three times the width. Find the dimensions of the rectangle.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A mutation that occurs in the gametes of an organism will most likely be transferred where
The_____ form acidic compounds with hydrogen.