jasminepsanchez jasminepsanchez
  • 01-06-2021
  • Mathematics
contestada

please help im very confused

please help im very confused class=

Respuesta :

sreedevi102
sreedevi102 sreedevi102
  • 01-06-2021

Answer:

option D : 130°

Step-by-step explanation:

m∠2 = m∠7 = 130° , (corresponding angles)

Answer Link

Otras preguntas

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
what's the percentage of 1/8 ?