nashwini160504
nashwini160504 nashwini160504
  • 02-05-2021
  • Biology
contestada

where is 70s type of ribosomes found in eukaryotic cells?​

Respuesta :

aprilzakula
aprilzakula aprilzakula
  • 02-05-2021

Answer:

All prokaryotes have 70S (where S=Svedberg units) ribosomes while eukaryotes contain larger 80S ribosomes in their cytosol. The 70S ribosome is made up of a 50S and 30S subunits. Ribosomes play a key role in the catalysis of two important and crucial biological processes.

Answer Link

Otras preguntas

Collusive strategies are the third type of cooperative strategies. In many economies, explicit collusive strategies are legal unless otherwise sanctioned by gov
^5sqrt4x^2 ^5sqrt4^2
which ones are rational 1. 2.4 2. 74 3. 17.3333333… 4. π 5. 6. –18 7. 8. 87.125 9. –30 10. –8.3 11. 58.25 12. 121 13. 4.5 14.3 7/10
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Read each verbal expression Then assign a variable and distribute
Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254
Which two states were admitted to the united states as part of the missouri compromise?
zimmerman note definition
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
El clima de la costa Guatemalteca es tropical, es decir es ______________________.