thomasrad2013 thomasrad2013
  • 03-02-2021
  • Mathematics
contestada

Pleas help me answer this question

Pleas help me answer this question class=

Respuesta :

Аноним Аноним
  • 03-02-2021

Answer:

so the correct answer is B

Step-by-step explanation:

40:5=8

3 x8= 24

have a nice day! (^o^)

Answer Link

Otras preguntas

At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil
can someone help me please
If a car's __________ is malfunctioning, people in the car will become ill when driving long distances, especially if the windows are closed. A. braking system
the members of an animal community are usually similar in
The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa
If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?
Quadrilateral abcd is inscribed in this circle. what is the measure of angle a?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
need help anybody know how to do this
Exponential Equation WITHOUT CALCULATOR