Seudónimo Seudónimo
  • 01-07-2020
  • Chemistry
contestada

the first man made fibre is _____
​

Respuesta :

saltywhitehorse saltywhitehorse
  • 07-07-2020

Answer:

Rayon

Explanation:

Rayon developed for the first time in the late 19th century as a replacement for silk. Silk was expensive in those days as was an organic product made out of cocoons. Rayon was the first man-made fibre came to be known as an artificial textile material formed from cellulose obtained from plants. Rayon was a less expensive option for silk clothing and accessories.

Answer Link

Otras preguntas

¿Por qué decide Ceci que esta vez sí va a completar el diario?
What is fast fashion designed to be? a recycled blong - lasting c inexpensive d easy to wash
solve for A 6a = -30
how does earthquakes connects to natural environments
Which is FALSE regarding binary fission? O Daughter cells are identical to each other. O it leads to genetic variation O It is a type of asexual reproduction O
Please help will give Brainlist if correct
At a local movie theater, the ratio of adult tickets sold to children's tickets sold is 5 to 6
Different plants and crops grow in different environments. What evidence from the text supports this conclusion? “Not all our favorite foods can come from loca
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Which hiker walks farther in one hour which is faster