taron991 taron991
  • 04-05-2020
  • Biology
contestada

What is another natural source for CO2

Respuesta :

katherinezarceno
katherinezarceno katherinezarceno
  • 04-05-2020
Answer: plants and animals respiration
Answer Link

Otras preguntas

_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Please answer theses division problems!! 9 divided by 3/7
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
define concentric circles
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7