cathy058 cathy058
  • 05-08-2016
  • Mathematics
contestada

Can someone help me with the second question?

Can someone help me with the second question class=

Respuesta :

Whalelover101 Whalelover101
  • 05-08-2016
20 ×5=100 100-2=98 the answer would be she gave her back $2 because if you round u get 2 (I'm sorry if this makes no sense)
Answer Link

Otras preguntas

30. Chronic alcohol abuse damages T-cells, white blood cells, natural killer cells, and __________, all important components of the immune system. A. acetaldehy
what is the theoretical probability of picking a diamond from a standard deck of car
Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho
Need help ASAP !!!!!!!
7. A company's marginal revenue is $10, its marginal cost is $10, and its price is $10. This company is operating in a/an _______ market structure. A
describe five ways to set strategy for effectively gathering patients information
The federalist papers were published in 1787 and 1788 to help gain support for
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The exodus of medical professionals from africa to europe is an example of brain drain as it has the potential to __________.
The culture of children strongly approves of children tattling on one and other. a. True b. False