zoeykellagher zoeykellagher

01-03-2020
Social Studies

contestada

How does a merit system improve the government?

Respuesta :

janyiaw30 janyiaw30

01-03-2020

supposed to help the U.S. slowly make the transition from U.S. customary units to SI units. Because this law did not completely restrict the use of U.S. customary units, it is still the most common system of measurement in the U.S. today.

Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?

Why was wilson not able to finish his speaking tour

The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.

What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Please help solve, thanks in advance!

how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front

what rule does static electricity follow