myaimaniwade myaimaniwade

03-02-2020
Mathematics

contestada

A rectangle has a length six inches less than twice it’s width. If the perimeter of the rectangle is 54 inches, find the dimensions.

Respuesta :

gracedowd2 gracedowd2

04-02-2020

Answer:

Step-by-step explanation:

width = W

length = L= 2W-6

P = 2L+2W

84=2(2W-6) + 2W

84= 4W -12 + 2W

84 = 6W -12

84+12 = 6W

96 = 6W

W=16

Solution

W=16

L = 2(16)-6 = 32-6 = 26

Answer Link

Otras preguntas

A client with severe shortness of breath comes to the emergency department. The client tells the emergency department staff that they recently traveled to China

LOTS OF POINTS IM DESPERATE! can someone please refresh my memory on a couple of log equations? Thank you!

The perimeter of a rectangle is 50 inches. If the width of the rectangle is 10 inches, what is the length? OA. 25 inches OB. 30 inches OC. 40 inches OD. 15 inch

Density is a physical property that relates the mass of a substance to its volume. Calculate the density, in g / mL , of a liquid that has a mass of 0.175 g and

Please answer this question

Y=3xπ-5 need help to solve this Algebra problem

Convert: ? kilometers = 10,000 meters

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Can someone help me with these problems I don’t understand them

Which of the following is NOT a class of annelid?