loops12o loops12o
  • 05-06-2018
  • Mathematics
contestada

simplify 5(-2)(-11)
[tex]5( - 2)( - 11[/tex]

Respuesta :

altavistard
altavistard altavistard
  • 07-06-2018
5(-2) = -10, so    5(-2)(-11) = (-10)(-11) = 110
Answer Link

Otras preguntas

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?
The temperature on a cloudy night is likely to be __________ those on a clear night all other factors being equal
hich of the following sentences is correct? A. Seven thousands of people showed up for the concert. B. Does anyone know why Steve ordered five dozens of eggs? C
A 5-card hand is dealt from a deck of 52 cards. what is the probability that 4 are hearts
Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
[xtra points] [urgent] Jim wants to buy two books for $10.00 each. By what percent is the total cost of the two books reduced during the sale?
Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.
I need the answer and the path work ok
Can you plz help me I don’t know what alliteration I tried searching it up on google but I don’t understand